Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATCATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGTGAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATACAGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTGTATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGGGATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGACTTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Benjamin Stump et al.
PloS one, 14(4), e0213831-e0213831 (2019-04-10)
Lymphatic vessels play an important role in health and in disease. In this study, we evaluated the effects of GSK3-β inhibition on lung lymphatic endothelial cells in vitro. Pharmacological inhibition and silencing of GSK3-β resulted in increased lymphangiogenesis of lung
Javier Duran et al.
PloS one, 11(12), e0168255-e0168255 (2016-12-16)
Testosterone induces cardiac hypertrophy through a mechanism that involves a concerted crosstalk between cytosolic and nuclear signaling pathways. Nuclear factor of activated T-cells (NFAT) is associated with the promotion of cardiac hypertrophy, glycogen synthase kinase-3β (GSK-3β) is considered to function
Baocheng Hu et al.
The Journal of biological chemistry, 292(8), 3531-3540 (2017-01-18)
miR-21, as an oncogene that overexpresses in most human tumors, is involved in radioresistance; however, the mechanism remains unclear. Here, we demonstrate that miR-21-mediated radioresistance occurs through promoting repair of DNA double strand breaks, which includes facilitating both non-homologous end-joining
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU079451-50UG | 04061831373295 |
| EHU079451-20UG | 04061831363333 |