Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Beilei Zhang et al.
Cancer letters, 459, 50-58 (2019-06-05)
MicroRNAs (miRNAs) were involved in cancer progression, and the targeting of miRNAs by natural agents has opened avenues for cancer treatment and drug development. miR-16 functions as a tumor suppressor and is frequently deleted or downregulated in various human cancers
Gireedhar Venkatachalam et al.
Nucleic acids research, 45(18), 10564-10582 (2017-10-07)
Although oxidative stress has been shown to induce senescence and replication stress independently, no study has implicated unresolved replication stress as the driver for cellular senescence in response to oxidative stress. Using cells exposed to increasing concentrations of hydrogen peroxide
Myriam Fezai et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 41(6), 2279-2288 (2017-05-01)
Injury by the sting of Lesser weever fish (Trachinus vipera) may lead to severe pain, edema or tissue necrosis. Cellular effects of the venom are still incompletely understood. Previous observations revealed that purified Lesser weever fish venom (LWFV) induces suicidal
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU123221-20UG | 04061831359329 |
| EHU123221-50UG | 04061831375091 |