EMU016021
MISSION® esiRNA
targeting mouse Smad4
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACAAGGTGGGGAAAGTGAAACCTTTGCAAAAAGAGCAATTGAGAGTTTGGTAAAGAAGCTGAAAGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGCAAGTGTGTCACCATACAGAGAACATTGGATGGACGACTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTGTGGAGGTGGCCTGATCTACACAAGAATGAACTAAAGCATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGACAGTGTCTGTGTGAATCCATATCACTATGAGCGGGTTGTCTCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCAAGTATGTTAGTGAAGGATGAGTACGTTCACGACTTTGAAGGACAGCCGTC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... SMAD4(17128), Smad4(17128)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ri Youn Kim et al.
Tissue engineering. Part A, 21(13-14), 2076-2088 (2015-04-04)
Clinical data show that estrogen levels are inversely associated with the production of sclerostin, a Wnt antagonist that recently attracted great attention over the use of its antibody in the anabolic treatment of osteoporotic conditions. However, the molecular link between
Kwangho Kim et al.
Molecular and cellular biochemistry, 407(1-2), 143-149 (2015-06-07)
Bioflavonoids are known to induce cardioprotective effects by inhibiting vascular smooth muscle cell (VSMC) proliferation and migration. Kaempferol has been shown to inhibit VSMC proliferation. However, little is known about the effect of kaempferol on VSMC migration and the underlying
Jennifer C Bailey et al.
Immunology, 143(4), 679-691 (2014-07-06)
CD1d-mediated lipid antigen presentation activates a subset of innate immune lymphocytes called invariant natural killer T (NKT) cells that, by virtue of their potent cytokine production, bridge the innate and adaptive immune systems. Transforming growth factor (TGF-β) is a known
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU016021-20UG | 04061831337785 |
| EMU016021-50UG | 04061831368772 |