Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGTTGCTGGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTACATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCCATCCTTGAATTACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCATGGTGATGGTGTTGAAGAAGCTTTTTATACAACAGATCGTGTAATGACGGTATCATTCCATAAATATGGGGAATACTTTCCTGGCACAGGAGACTTGAGGGATATTGGTGCTGGAAAAGGCAAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAGATGATGAGTCATATGGGCAGATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGCTGTGGTATTACAGTGTGGTGCAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
常规特殊物品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
David B Wang et al.
Brain pathology (Zurich, Switzerland), 29(2), 164-175 (2018-07-22)
Histone deacetylases (HDACs) catalyze acetyl group removal from histone proteins, leading to altered chromatin structure and gene expression. HDAC2 is highly expressed in adult brain, and HDAC2 levels are elevated in Alzheimer's disease (AD) brain. We previously reported that neuron-specific
Shenglei Li et al.
Oncology letters, 13(1), 403-409 (2017-01-27)
Increasing evidence has demonstrated that histone deacetylase 2 (HDAC2) participates in the regulation of a variety of biological processes in numerous tumors. However, the potential role of HDAC2 in the development and progression of esophageal squamous cell carcinoma (ESCC) remains
Wei Dai et al.
World journal of gastroenterology, 25(38), 5789-5799 (2019-10-23)
Hepatocellular carcinoma (HCC) has become a great threat for people's health. Many long noncoding RNAs are involved in the pathogenesis of HCC. SNHG15, as a tissue specific long noncoding RNAs, has been studied in many human cancers, except HCC. To
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU002001-20UG | 04061831360134 |
| EHU002001-50UG | 04061831370300 |