Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATGAGGTTGGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Luiz Felipe M Prota et al.
PloS one, 7(12), e47405-e47405 (2012-12-29)
Dexamethasone is widely used for pulmonary exacerbation in patients with cystic fibrosis, however, not much is known about the effects of glucocorticoids on the wild-type cystic fibrosis channel transmembrane regulator (CFTR). Our aim was to determine the effects of dexamethasone
Maria Favia et al.
Molecular biology of the cell, 21(1), 73-86 (2009-11-06)
We have demonstrated that Na(+)/H(+) exchanger regulatory factor 1 (NHERF1) overexpression in CFBE41o- cells induces a significant redistribution of F508del cystic fibrosis transmembrane conductance regulator (CFTR) from the cytoplasm to the apical membrane and rescues CFTR-dependent chloride secretion. Here, we
Pascale Marcorelles et al.
The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society, 62(11), 791-801 (2014-07-27)
Cystic Fibrosis Transmembrane conductance Regulator (CFTR) protein has recently been shown to be expressed in the human adult central nervous system (CNS). As CFTR expression has also been documented during embryonic development in several organs, such as the respiratory tract
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU020491-50UG | 04061831371116 |
| EHU020491-20UG | 04061831340280 |