Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCAAGACGGAGCAGCTGAGCCCCAGCCACTACAGCGAGCAGCAGCAGCACTCGCCCCAACAGATCGCCTACAGCCCCTTCAACCTCCCACACTACAGCCCCTCCTACCCGCCCATCACCCGCTCACAGTACGACTACACCGACCACCAGAACTCCAGCTCCTACTACAGCCACGCGGCAGGCCAGGGCACCGGCCTCTACTCCACCTTCACCTACATGAACCCCGCTCAGCGCCCCATGTACACCCCCATCGCCGACACCTCTGGGGTCCCTTCCATCCCGCAGACCCACAGCCCCCAGCACTGGGAACAACCCGTCTACACACAGCTCACTCGACCTTGAGGAGGCCTCCCACGAAGGGCGAAGATGGCCGAGATGATCCTAAAAATAACCGAAGAAAGAGAGGACCAACCAGAATTCCCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Corinne Prévostel et al.
Oncotarget, 7(50), 82228-82243 (2016-07-19)
SOX9 inactivation is frequent in colorectal cancer (CRC) due to SOX9 gene mutations and/or to ectopic expression of MiniSOX9, a dominant negative inhibitor of SOX9. In the present study, we report a heterozygous L142P inactivating mutation of SOX9 in the
Haiyun Luo et al.
Journal of endodontics, 44(5), 792-799 (2018-03-25)
The process of pulpitis is characterized by extracellular matrix imbalance and inflammatory cell infiltration. As an essential transcription factor, sex-determining region Y-box 9 (SOX9) is significantly inhibited by tumor necrosis factor alpha in inflammatory joint diseases. The aim of this
Jing Wang et al.
Oncotarget, 8(1), 574-582 (2016-11-24)
Cisplatin-based chemotherapy is the most commonly used treatment regimen for gastric cancer (GC), however, the resistance to cisplatin represents the key limitation for the therapeutic efficacy. Aberrant expression of MiR-524-5p appears to be involves in tumorigenesis and chemoresistance. However, the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU021061-20UG | 04061831340372 |
| EHU021061-50UG | 04061831371130 |