Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCAAGCTCTTCTGGCAGTGATTCTGACAGTGAGGTTGACAAAAAGTTAAAGAGGAAAAAGCAAGTTGCTCCAGAAAAACCTGTAAAGAAACAAAAGACAGGTGAGACTTCGAGAGCCCTGTCATCTTCTAAACAGAGCAGCAGCAGCAGAGATGATAACATGTTTCAGATTGGGAAAATGAGGTACGTTAGTGTTCGCGATTTTAAAGGCAAAGTGCTAATTGATATTAGAGAATATTGGATGGATCCTGAAGGTGAAATGAAACCAGGAAGAAAAGGTATTTCTTTAAATCCAGAACAATGGAGCCAGCTGAAGGAACAGATTTCTGACATTGATGATGCAGTAAGAAAACTGTAAAATTCGAGCCATATAAATAAAACCTGTACTGTTCTAGTTGTTTTAATCTGTCTTTTTACATTGGCTTTTGTTTTCTAAATGTTCTCCAAGCTATTGTATGTTTGGATTGCAGAAGAATTTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
B V S K Chakravarthi et al.
Oncogene, 35(49), 6330-6340 (2016-06-09)
MicroRNA-101, a tumor suppressor microRNA (miR), is often downregulated in cancer and is known to target multiple oncogenes. Some of the genes that are negatively regulated by miR-101 expression include histone methyltransferase EZH2 (enhancer of zeste homolog 2), COX2 (cyclooxygenase-2)
Shaolin Tao et al.
American journal of cancer research, 5(6), 1878-1889 (2015-08-14)
Human transcriptional positive cofactor 4 (PC4) is a novel marker for diagnosis and treatment of advanced human cancers metastasis. In human lung adenocarcinoma, tumor lymphangiogenesis, an important early event, can promotes lymphatic metastasis, while it has been reported that VEGF-C/VEGF-D/VEGFR-3
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU031131-20UG | 04061831350746 |
| EHU031131-50UG | 04061828344833 |