Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGATTTCTTGGGTCTCCAGGACAAGATCAAGGAGGTCCCCCGCCCGAGGAAGCGGCTGACGGAACTGCTGCTTCGAACGGCCACAGAGAAGCCAGGGCCGGCGGAAGCTGCCCGCCAGGCATCGGCCTCCCGTGCCTGGGGCCTCCGCTTTTTCCGAAGCCCCCAGCAGGTGCTGCCCTCACCAGATGGGCGGCGGGCAGCAGGTGTCCGCCTAGCAGTCACTAGACTGGAGGGTGTCGATGAGGCCACCCGTGCAGTGCCCACGGGAGACATGGAAGACCTCCCTTGTGGGCTGGTGCTCAGCAGCATTGGGTATAAGAGCCGCCCTGTCGACCCAAGCGTGCCCTTTGACTCCAAGCTTGGGGTCATCCCCAATGTGGAGGGCCGGGTTATGGATGTGCCAGGCCTCTACTGCAGCGGCTGGGTGAAGAGAGGACCTACAGGTGTCATAGCCACAACCATGACTGACAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU034841-20UG | 04061828545575 |
| EHU034841-50UG | 04061828310203 |