Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTCATCAACGCAGCTGAGAAACTCCAGGTGGTGGGCAGGGCTGGCACAGGTGTGGACAATGTGGATCTGGAGGCCGCAACAAGGAAGGGCATCTTGGTTATGAACACCCCCAATGGGAACAGCCTCAGTGCCGCAGAACTCACTTGTGGAATGATCATGTGCCTGGCCAGGCAGATTCCCCAGGCGACGGCTTCGATGAAGGACGGCAAATGGGAGCGGAAGAAGTTCATGGGAACAGAGCTGAATGGAAAGACCCTGGGAATTCTTGGCCTGGGCAGGATTGGGAGAGAGGTAGCTACCCGGATGCAGTCCTTTGGGATGAAGACTATAGGGTATGACCCCATCATTTCCCCAGAGGTCTCGGCCTCCTTTGGTGTTCAGCAGCTGCCCCTGGAGGAGATCTGGCCTCTCTGTGATTTCATCACTGTGCACACTCCTCTCCTGCCCTCCACGACAGGCTTGCTGAATGACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wen-Bin Guo et al.
Reproductive biology and endocrinology : RB&E, 18(1), 70-70 (2020-07-16)
Although varicocele is considered to be one of the leading causes of male infertility, the precise mechanism underlying how varicocele leads to male infertility is not completely understood. We found the lactate concentration on the varicocele side of the patients
Mai Q Nguyen et al.
The Journal of investigative dermatology, 140(11), 2242-2252 (2020-05-12)
Melanomas frequently harbor activating NRAS mutations leading to activation of MAPK kinase (MEK) and extracellular signal-regulated kinase 1/2 signaling; however, the clinical efficacy of inhibitors to this pathway is limited by resistance. Tumors rewire metabolic pathways in response to stress
Florence Polet et al.
Oncotarget, 7(2), 1765-1776 (2015-12-02)
Leukemia cells are described as a prototype of glucose-consuming cells with a high turnover rate. The role of glutamine in fueling the tricarboxylic acid cycle of leukemia cells was however recently identified confirming its status of major anaplerotic precursor in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU035111-20UG | 04061831341232 |
| EHU035111-50UG | 04061828310470 |