Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGGTCCAACTCCAATCCAGTCACTACAGTATGCAACAAGTCAGGACATTATTAATTCTTTTCAAAGTATTAGACAAGAAATGGAAGCTTATACACCCAAGTTAACTCAGGTTCTCTCAAGTAGTGCTGCCAGTAGTACCATCACAGCACTGTCACCTGGAGGGGCACTTATGCAGGGAGGAACACAGCAAGCCATAAACCAGATGGTGCCAAATGATATTCAATCTGAATTGAAACACTTATATGTAGCTGTTGGAGAACTTCTACGACATTTCTGGTCCTGCTTTCCTGTTAATACGCCATTCCTAGAAGAAAAGGTAGTGAAAATGAAAAGTAATTTGGAACGATTCCAAGTTACGAAGCTCTGTCCATTCCAAGAAAAGATTCGGAGACAGTATTTAAGCACAAATTTGGTAAGTCACATAGAAGAGATGCTCCAGACAGCCTACAACAAGCTCCACACATGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Leticia M Ignacio-Souza et al.
Endocrinology, 155(8), 2831-2844 (2014-06-04)
In both human and experimental obesity, inflammatory damage to the hypothalamus plays an important role in the loss of the coordinated control of food intake and energy expenditure. Upon prolonged maintenance of increased body mass, the brain changes the defended
Kaori Kojima et al.
Neuroscience letters, 581, 37-41 (2014-08-26)
p62, which is also called sequestosome 1 (SQSTM1), plays a critical role in neuronal cell death. However, the role of p62 in axonal degeneration remains unclear. We evaluated whether the modulation of p62 expression may affect axonal loss in tumor
Young-Ok Son et al.
The Journal of biological chemistry, 289(41), 28660-28675 (2014-08-27)
The cadmium-transformed human lung bronchial epithelial BEAS-2B cells exhibit a property of apoptosis resistance as compared with normal non-transformed BEAS-2B cells. The level of basal reactive oxygen species (ROS) is extremely low in transformed cells in correlation with elevated expressions
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU038861-20UG | 04061828533824 |
| EHU038861-50UG | 04061828298532 |