Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGTCTGAGGATGGGAAGGTACAGGTGACCCGGCCAGACCAAGCCCGCATGGACATTAGGTTAGCCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATCATCTGCTGGGGCCCTCTGCTTGCAATCATGGTGTATGATGTCTTTGGGAAGATGAACAAGCTCATTAAGACGGTGTTTGCATTCTGCAGTATGCTCTGCCTGCTGAACTCCACCGTGAACCCCATCATCTATGCTCTGAGGAGTAAGGACCTGCGACACGCTTTCCGGAGCATGTTTCCCTCTTGTGAAGGCACTGCGCAGCCTCTGGATAACAGCATGGGGGACTCGGACTGCCTGCACAAACACGCAAACAATGCAGCCAGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACGGTCAAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Le Yang et al.
Molecular therapy. Nucleic acids, 20, 725-738 (2020-05-15)
Nod-like receptor (NLR) family pyrin domain containing 3 (NLRP3) has been regarded as an important initiator or promoter in multiple inflammatory diseases. However, the relationship between cannabinoid receptor 1 (CB1) and macrophage NLRP3 inflammasome and the corresponding molecular mechanism in
Elena Ciaglia et al.
Oncotarget, 6(17), 15464-15481 (2015-05-27)
Herein we show that a majority of human brain tumor samples and cell lines over-expressed cannabinoid receptor CB1 as compared to normal human astrocytes (NHA), while uniformly expressed low levels of CB2. This finding prompted us to investigate the therapeutic
Chih-Yuan Lin et al.
Journal of molecular and cellular cardiology, 85, 249-261 (2015-06-21)
Cannabinoid receptor type 1 (CB1R) plays an important role in the development of myocardial hypertrophy and fibrosis-2 pathological features of uremic cardiomyopathy. However, it remains unknown whether CB1R is involved in the pathogenesis of uremic cardiomyopathy. Here, we aimed to
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU044261-20UG | 04061828550494 |
| EHU044261-50UG | 04061831362619 |