Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACAACTTTGTGCACGACTGCGTCAATATCACAATCAAGCAGCACACGGTCACCACAACCACCAAGGGGGAGAACTTCACCGAGACCGACGTTAAGATGATGGAGCGCGTGGTTGAGCAGATGTGTATCACCCAGTACGAGAGGGAATCTCAGGCCTATTACCAGAGAGGATCGAGCATGGTCCTCTTCTCCTCTCCACCTGTGATCCTCCTGATCTCTTTCCTCATCTTCCTGATAGTGGGATGAGGAAGGTCTTCCTGTTTTCACCATCTTTCTAATCTTTTTCCAGCTTGAGGGAGGCGGTATCCACCTGCAGCCCTTTTAGTGGTGGTGTCTCACTCTTTCTTCTCTCTTTGTCCCGGATAGGCTAATCAATACCCTTGGCACTGATGGGCACTGGAAAAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Heather Bender et al.
PloS one, 14(7), e0219995-e0219995 (2019-07-23)
Prion diseases are members of neurodegenerative protein misfolding diseases (NPMDs) that include Alzheimer's, Parkinson's and Huntington diseases, amyotrophic lateral sclerosis, tauopathies, traumatic brain injuries, and chronic traumatic encephalopathies. No known therapeutics extend survival or improve quality of life of humans
Yong-Seok Han et al.
Cell death & disease, 7(10), e2395-e2395 (2016-10-07)
Mesenchymal stem cells (MSCs) are 'adult' multipotent cells that promote regeneration of injured tissues in vivo. However, differences in oxygenation levels between normoxic culture conditions (21% oxygen) and both the MSC niche (2-8% oxygen) and ischemic injury-induced oxidative stress conditions
Stefano Martellucci et al.
International journal of molecular sciences, 20(2) (2019-01-19)
Human Dental Pulp Stem Cells (hDPSCs) represent a type of adult mesenchymal stem cells that have the ability to differentiate in vitro in several lineages such as odontoblasts, osteoblasts, chondrocytes, adipocytes and neurons. In the current work, we used hDPSCs
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU046551-20UG | 04061831342833 |
| EHU046551-50UG | 04061831371734 |