Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACAATTCATGGAGCCAGGTTATCCCAAAAGCATATCAGGTGCCTTTCCAGGAATAGAGAGTAAAGTTGATGCAGTTTTCCAGCAAGAACATTTCTTCCATGTCTTCAGTGGACCAAGATATTACGCATTTGATCTTATTGCTCAGAGAGTTACCAGAGTTGCAAGAGGCAATAAATGGCTTAACTGTAGATATGGCTGAAGCAAAATCAAATGTGGCTGTATCCACTTTCAGAATGTTGAAGGGAAGTTCAGCAAGCATTTTCGTTACATTGTGTCCTGCTTATACTTTTCTCAATATTAAGTCATTGTTTCCCATCACTGTATCCATTCTACCTGTCCTCCGTGAAAATATGTTTGGAATATTCCACTATTTGCAGAGGCTTATTCAGTTCTTACACATTCCATCTTACATTAGTGATTCCATCAAAGAGAAGGAAAGTAAGCCTTTTTGTCACC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Alexandra Schubert-Unkmeir et al.
PLoS pathogens, 6(4), e1000874-e1000874 (2010-05-06)
Disruption of the blood-brain barrier (BBB) is a hallmark event in the pathophysiology of bacterial meningitis. Several inflammatory mediators, such as tumor necrosis factor alpha (TNF-alpha), nitric oxide and matrix metalloproteinases (MMPs), contribute to this disruption. Here we show that
Muge Sarper et al.
Breast cancer research : BCR, 19(1), 33-33 (2017-03-24)
Normal myoepithelial cells (MECs) play an important tumour-suppressor role in the breast but display an altered phenotype in ductal carcinoma in situ (DCIS), gaining tumour-promoter functions. Matrix metalloproteinase-8 (MMP-8) is expressed by normal MECs but is lost in DCIS. This
Guanmei Wen et al.
The Journal of biological chemistry, 290(31), 19158-19172 (2015-06-21)
Matrix metalloproteinase-8 (MMP8) has been shown to influence various cellular functions. As monocytes and macrophages (Mφ) express MMP8, we investigated if MMP8 played a role in macrophage differentiation and polarization. MMP8 expression was significantly increased during monocyte differentiation into Mφ.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU047031-50UG | 04061828320356 |
| EHU047031-20UG | 04061828555680 |