Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCGCAGACCTTGTGATATTCCAGTTCCCCCTGCAGTGGTTTGGAGTCCCTGCCATTCTGAAAGGCTGGTTTGAGCGAGTGTTCATAGGAGAGTTTGCTTACACTTACGCTGCCATGTATGACAAAGGACCCTTCCGGAGTAAGAAGGCAGTGCTTTCCATCACCACTGGTGGCAGTGGCTCCATGTACTCTCTGCAAGGGATCCACGGGGACATGAATGTCATTCTCTGGCCAATTCAGAGTGGCATTCTGCATTTCTGTGGCTTCCAAGTCTTAGAACCTCAACTGACATATAGCATTGGGCACACTCCAGCAGACGCCCGAATTCAAATCCTGGAAGGATGGAAGAAACGCCTGGAGAATATTTGGGATGAGACACCACTGTATTTTGCTCCAAGCAGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Brian Madajewski et al.
Molecular cancer research : MCR, 14(1), 14-25 (2015-11-11)
The fundamental role that NAD(P)H/quinone oxidoreductase 1 (NQO1) plays, in normal cells, as a cytoprotective enzyme guarding against stress induced by reactive oxygen species (ROS) is well documented. However, what is not known is whether the observed overexpression of NQO1
Xiang-Zhai Zhao et al.
OncoTargets and therapy, 11, 3609-3617 (2018-06-29)
Spindlactone A (SPL-A) is a novel small molecule inhibitor of TACC3 that selectively inhibits the nucleation of centrosome microtubules and induces mitotic arrest in ovarian cancer cells. SPL-A is derived from dicoumarol which inhibits the activity of NAD(P)H dehydrogenase quinone
Siriwoot Butsri et al.
Oncology letters, 13(6), 4540-4548 (2017-06-11)
We previously reported that upregulation of NAD(P)H:quinone oxidoreductase 1 (NQO1) in cholangiocarcinoma (CCA; a fatal bile duct cancer) was associated with poor prognosis. It was also demonstrated that the suppression of NQO1 was able to enhance the chemosensitivity of CCA
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU047441-20UG | 04061828556052 |
| EHU047441-50UG | 04061828320752 |