Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAGCTTCCAAGTCCCTCTTCTTTCCAGATGAAGCAATAAACAAGCACCCTCGCTTCAGTACCTTAACAAGAAATATCCGACATAGGAGAGGAGAAAAGGTTGTCATCAATGTACCAATATTTAAGGACAAGAATACACCATCTCCATTTATAGAAACATTTACTGAGGATGATGAAGCTTCAAGGGCTTCTAAGCCGGATCATATTTACATGGATGCCATGGGATTTGGAATGGGCAATTGCTGTCTCCAGGTGACATTCCAAGCCTGCAGTATATCTGAGGCCAGATACCTTTATGATCAGTTGGCTACTATCTGTCCAATTGTTATGGCTTTGAGTGCTGCATCTCCCTTTTACCGAGGCTATGTGTCAGACATTGATTGTCGCTGGGGAGTGATTTCTGCATCTGTAGATGATAGAACTCGGGAGGAGCGAGGACTGGAGCCATTGAAGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Preeti Kanikarla-Marie et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(6), 2160-2170 (2015-11-26)
Type 1 diabetic (T1D) patients have a higher incidence of liver disease. T1D patients frequently experience elevated plasma ketone levels along with hyperglycemia. However, no study has examined whether hyperketonemia per se has any role in excess liver damage in
Dulani Wimalachandra et al.
Biochimica et biophysica acta, 1863(1), 71-80 (2017-10-21)
Endometriosis is a disease characterized by regurgitated lesions which are invasive and migratory, embedding at ectopic, extra-uterine locations. Extracellular glucosylceramides (GlcCers), bioactive sphingolipids potentiating signals for cell migration, are found in elevated levels in endometriosis; however underlying mechanisms that result
Arunkumar E Achari et al.
Archives of biochemistry and biophysics, 630, 54-65 (2017-08-02)
Diabetic patients have lower blood levels of l-cysteine (LC) and glutathione (GSH). This study examined the hypothesis that LC supplementation positively up regulates the effects of insulin on GSH and glucose metabolism in 3T3-L1 adipocyte model. 3T3L1 adipocytes were treated
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU048791-20UG | 04061831343236 |
| EHU048791-50UG | 04061828334902 |