Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGGGCATCATCAATTTCGAGCAGAAGGCAAGGGCTGGGACGGAGGCTTTGAAGGTGTGGGGAAGCATTAAAGGACTGACTGAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATTGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAAACATTCCCTTGGATGTAGTCTGAGGCCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sujay Gaikwad et al.
Journal of biochemical and molecular toxicology, 32(9), e22176-e22176 (2018-07-12)
Anaplastic thyroid carcinoma (ATC) requires more innovative approaches as the current regimes for therapy are inadequate, also most anticancer drugs cause general suppression of physiological functions. However, therapy with limited nontarget tissue damage is desirable. In the present study, we
Bindu Thapa et al.
Human gene therapy, 30(12), 1531-1546 (2019-09-25)
Preclinical studies showed that tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) therapy is safe and effective to combat cancers, but clinical outcomes have been less than optimal due to short half-life of TRAIL protein, insufficient induction of apoptosis, and TRAIL resistance
Yun-Li Wu et al.
Toxicology and applied pharmacology, 377, 114626-114626 (2019-06-16)
Microcystin-LR (MC-LR) is a type of cyclic heptapeptide toxin produced by cyanobacteria during bloom events. MC-LR-induced cell death is critically involved in its potent specific hepatotoxicity. Many studies have demonstrated that prototypical apoptosis as a form of programmed cell death
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU050511-20UG | 04061831343533 |
| EHU050511-50UG | 04061828336524 |