Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCTCTCCTTGTCGCTCATAAAGTCCGAGTGCGGCGATCTTCAAGATATGTCTGAAATATCACCTTATTCGGGAAACTCTATGGAGGAAGGATTGTCACCCAATCACTTGAAAAAAGCAAAGCTCATGTTTTTTTATACCCGTTATCCCAGCTCCAATATGCTGAAGACCTACTTCTCCGACGTAAAGTTCAACAGATGCATTACCTCTCAGCTCATCAAGTGGTTTAGCAATTTCCGTGAGTTTTACTACATTCAGATGGAGAAGTACGCACGTCAAGCCATCAACGATGGGGTCACCAGTACTGAAGAGCTGTCTATAACCAGAGACTGTGAGCTGTACAGGGCTCTGAACATGCACTACAATAAAGCAAATGACTTTGAGGTTCCAGAGAGATTCCTGGAAGTTGCTCAGATCACATTACGGGAGTTTTTCAATGCCATTATCGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chang Rae Rho et al.
Investigative ophthalmology & visual science, 56(10), 5871-5879 (2015-09-09)
Prospero homeobox 1 (Prox1) siRNA is a small interfering RNA that is designed to specifically bind Prox1 mRNA. We determined whether Prox1 siRNA inhibits lymphangiogenesis and hemangiogenesis after acute corneal inflammation. Three Prox1 siRNAs were synthesized and investigated for their
Kang-Jin Park et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 20(1), 104-115 (2016-01-14)
Prospero homeobox 1 (PROX1) functions as a tumor suppressor gene or an oncogene in various cancer types. However, the distinct function of PROX1 in gastric cancer is unclear. We determined whether PROX1 affected the oncogenic behavior of gastric cancer cells
Toshihiko Goto et al.
FEBS letters, 591(4), 624-635 (2017-01-28)
Previous reports have revealed that Prospero-related homeobox 1 (Prox1) is required for the migration and differentiation of hepatoblasts during embryonic liver formation. However, the role of Prox1 in adults remains to be elucidated. We created liver-specific Prox1 knockout mice to
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU053851-20UG | 04061831344004 |
| EHU053851-50UG | 04061831362657 |