Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTATCCTCGTGGACTGGTTAGTTGAAGTAGGAGAAGAATATAAACTACAGAATGAGACCCTGCATTTGGCTGTGAACTACATTGATAGGTTCCTGTCTTCCATGTCAGTGCTGAGAGGAAAACTTCAGCTTGTGGGCACTGCTGCTATGCTGTTAGCCTCAAAGTTTGAAGAAATATACCCCCCAGAAGTAGCAGAGTTTGTGTACATTACAGATGATACCTACACCAAGAAACAAGTTCTGAGAATGGAGCATCTAGTTTTGAAAGTCCTTACTTTTGACTTAGCTGCTCCAACAGTAAATCAGTTTCTTACCCAATACTTTCTGCATCAGCAGCCTGCAAACTGCAAAGTTGAAAGTTTAGCAATGTTTTTGGGAGAATTAAGTTTGATAGATGCTGACCCATACCTCAAGTATTTGCCATCAGTTATTGCTGGAGCTGCCTTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Patrick E Gygli et al.
Aging, 8(7), 1540-1570 (2016-07-19)
Various stem cell niches of the brain have differential requirements for Cyclin A2. Cyclin A2 loss results in marked cerebellar dysmorphia, whereas forebrain growth is retarded during early embryonic development yet achieves normal size at birth. To understand the differential
Hemabindu Chintala et al.
Development (Cambridge, England), 142(13), 2364-2374 (2015-05-24)
Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete.
Yu Di et al.
Drug design, development and therapy, 9, 2463-2473 (2015-05-23)
CCN1 (also called Cyr 61) is an extracellular matrix signaling molecule that has been implicated in neovascularization through its interactions with several endothelial integrin receptors. The roles of vascular endothelial growth factor (VEGF) in angiogenesis are well described. The aim
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU056571-50UG | 04061828313730 |
| EHU056571-20UG | 04061828559626 |