Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGACATCCCAAGCCTTCTCCTTTCATTGGAAACTTGACATTTTTCCGCCAGGGTTTTTGGGAAAGCCAAATGGAGCTCAGAAAGCTGTATGGACCTCTGTGTGGGTACTATCTTGGTCGTCGGATGTTTATTGTTATTTCTGAGCCAGACATGATCAAGCAGGTGTTGGTTGAGAACTTCAGTAACTTTACCAACAGAATGGCGTCGGGTTTGGAGTTCAAGTCGGTAGCCGACAGCGTTCTGTTTTTACGTGACAAAAGATGGGAAGAGGTCAGAGGTGCCCTGATGTCTGCTTTCAGTCCTGAAAAGCTGAACGAGATGGTTCCCCTCATCAGCCAAGCCTGCGAACTTCTCCTGGCTCATTTAAAACGCTATGCGGAATCTGGGGACGCATTTGACATCCAGAGGTGCTACTGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hoe-Su Jeong et al.
Biochimica et biophysica acta, 1849(6), 709-721 (2015-03-01)
The ubiquitin-proteasome system (UPS) plays an important role in protein quality control, cellular signalings, and cell differentiation through the regulated turnover of key transcription factors in cardiac tissue. However, the molecular mechanism underlying Fbxo25-mediated ubiquitination of cardiac transcription factors remains
Hyun Su Lee et al.
Molecular medicine reports, 12(3), 4782-4788 (2015-06-24)
5‑Fluorouracil (5‑FU), one of the oldest anticancer therapeutic agents, is increasingly being administered in cancer chemotherapy. In the present study, the anticancer effects of 5‑FU combined with corosolic acid (CRA) were determined in SNU‑620 human gastric carcinoma cells and the
Chaitali N Mahajan et al.
Pediatric research, 77(3), 455-462 (2014-12-19)
Persistent pulmonary hypertension of the newborn (PPHN) is associated with decreased lung angiogenesis and impaired pulmonary vasodilatation at birth. Prostanoids are important modulators of vascular tone and angiogenesis. We hypothesized that altered levels of prostacyclin (PGI₂), a potent vasodilator, and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU060341-20UG | 04061831344769 |
| EHU060341-50UG | 04061828326846 |