Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCCTGTTGAAAGACCCTTGAAAGAGAACCCACCTAATAAAATGACCCAAGAAAAACTTGAAGAGTCAAGTACCATTGGCCAGGATCAAACGCTTATGGAACGTGATACAGAGGGTGGTGCAGCAGAAATTAATTGCAATGGAGTGATTGAAGTCATTAATTATACTCAGAACAGTAATAATGAAACATTGAGACATAAAGAGGATCTACATAATGCTAATGACTGTGATGTCCAAAATTTGAATCAGGAATCTAGTTTCCTAAGCTCCCAAAATGGAGACAGCAGCACATCTCAAGAAACAGACTCTTGTACACCTATAACATCTGAGGTGTCAGACACCATGGTGTGCCAGTCTTCCTCAACTGTAGGTCAGTCATTCAGTGAACAACACATTAGCCAACTTCAAGAAAGCATTCGGG
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Zhengbu Liao et al.
Molecular neurobiology, 54(3), 1818-1824 (2016-02-19)
Up to now, the serine-arginine protein kinase 1 (SRPK1) has been suggested as an important signal mediator, which is implicated in the development of cancers. Unfortunately, some molecular pathways in SRPK1-mediated epithelial-mesenchymal transition (EMT) in human spinal glioblastoma have been
Parmanand Malvi et al.
Oncogenesis, 9(8), 77-77 (2020-08-30)
Triple-negative breast cancer (TNBC) is a highly metastatic breast cancer subtype and due to the lack of hormone receptors and HER2 expression, TNBC has limited therapeutic options with chemotherapy being the primary choice for systemic therapy. LIM Domain Kinase 2
M V Gammons et al.
British journal of cancer, 111(3), 477-485 (2014-07-11)
Current therapies for metastatic melanoma are targeted either at cancer mutations driving growth (e.g., vemurafenib) or immune-based therapies (e.g., ipilimumab). Tumour progression also requires angiogenesis, which is regulated by VEGF-A, itself alternatively spliced to form two families of isoforms, pro-
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU061031-20UG | 04061828563142 |
| EHU061031-50UG | 04061831362947 |