Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGAAGTCAAAGAAATGCAAATATTCTTTCAAATGTGTAAATAGTCTCAAGGAAGATCATAACCAACCATTGTTTGGAGTTCAGTTTAACTGGCACAGTAAAGAAGGAGATCCATTAGTGTTTGCAACTGTAGGAAGCAACAGAGTTACCTTGTATGAATGTCATTCACAAGGAGAAATCCGGTTGTTGCAATCTTACGTGGATGCTGATGCTGATGAAAACTTTTACACTTGTGCATGGACCTATGATAGCAATACGAGCCATCCTCTGCTGGCTGTAGCTGGATCTAGAGGCATAATTAGGATAATAAATCCTATAACAATGCAGTGTATAAAGCACTATGTTGGCCATGGAAATGCTATCAATGAGCTGAAATTCCATCCAAGAGATCCAAATCTTCTCCTGTCAGTAAGTAAAGATCATGCTTTACGATTATGGAATATCCAGACGGACACTCTGGTGGCAATATTTGGAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Bing He et al.
Oncotarget, 8(61), 103919-103930 (2017-12-22)
The miRNAs play important regulating roles in the pathogenesis of hepatocellular carcinoma (HCC). To uncover key regulating miRNAs in HCC that were neglected by traditional analyzing methods of transcriptomics data, we proposed a novel molecular-network-based omics' (MNBO) method. With this
Houliang Deng et al.
Scientific reports, 9(1), 197-197 (2019-01-19)
Chromobox 6 (CBX6) is a subunit of Polycomb Repressive Complex 1 (PRC1) that mediates epigenetic gene repression and acts as an oncogene or tumor suppressor in a cancer type-dependent manner. The specific function of CBX6 in breast cancer is currently
Seong Won Lee et al.
Developmental cell, 46(1), 73-84 (2018-07-06)
The ability to convert human somatic cells efficiently to neurons facilitates the utility of patient-derived neurons for studying neurological disorders. As such, ectopic expression of neuronal microRNAs (miRNAs), miR-9/9∗ and miR-124 (miR-9/9∗-124) in adult human fibroblasts has been found to
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU062201-20UG | 04061831350982 |
| EHU062201-50UG | 04061828380022 |