Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGATTCAAACCAGGACTGTTCAGTCTTACACTGAATGAACGTTTCAGTATAAATGGTGGTTATCTGGGTATTCTAGAATGGATTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGTTCTGGAAAATAGCACAAGTTATGAAGAAGCCAAGAATTTATTGACCAAGACCAAGATATTGGCCCCAGCCTACTTTATCCTGGGAGGCAACCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGAATCATTGGATGTATATGAACTCGATGCTAAGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCATTTGAAACCATGTATGATGTCCTGTCAACAAAACCTGTCCTCAACAAGCTGACCGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Su-Fern Tan et al.
Journal of lipid research, 60(6), 1078-1086 (2019-04-10)
Acute myeloid leukemia (AML) is the most common acute leukemia in adults. More than half of older AML patients fail to respond to cytotoxic chemotherapy, and most responders relapse with drug-resistant disease. Failure to achieve complete remission can be partly
Su-Fern Tan et al.
Oncotarget, 7(50), 83208-83222 (2016-11-09)
There is an urgent unmet need for new therapeutics in acute myeloid leukemia (AML) as standard therapy has not changed in the past three decades and outcome remains poor for most patients. Sphingolipid dysregulation through decreased ceramide levels and elevated
Jennifer M Pearson et al.
Molecular cancer research : MCR, 18(3), 352-363 (2019-11-21)
Acute myeloid leukemia (AML) is a disease characterized by uncontrolled proliferation of immature myeloid cells in the blood and bone marrow. The 5-year survival rate is approximately 25%, and recent therapeutic developments have yielded little survival benefit. Therefore, there is
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU064111-20UG | 04061828606924 |
| EHU064111-50UG | 04061828381807 |