Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTCCAACAAGCACAAAGCAATGGCCTAAGAGAAGTCTCAGGAAAGCAGATGTAGAGGAAGAATTCTTAGCACTCAGGAAACTAACACCATCAGCAGGGAAAGCCATGCTTACGCCCAAACCAGCAGGAGGTGATGAGAAAGACATTAAAGCATTTATGGGAACTCCAGTGCAGAAACTGGACCTGGCAGGAACTTTACCTGGCAGCAAAAGACAGCTACAGACTCCTAAGGAAAAGGCCCAGGCTCTAGAAGACCTGGCTGGCTTTAAAGAGCTCTTCCAGACTCCTGGTCACACCGAGGAATTAGTGGCTGCTGGTAAAACCACTAAAATACCCTGCGACTCTCCACAGTCAGACCCAGTGGACACCCCAACAAGCACAAAGCAACGACCCAAGAGAAGTATCAGGAAAGCAGATGTAGAGGGAGAACTCTTAGCGTGCAGGAATCTAATGCCATCAGCAGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yusuke Horiuchi et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 19(1), 160-165 (2014-12-11)
The differences in the growth morphology, proliferative ability, and background mucosa of the cancer between Helicobacter pylori (HP)-positive (HP+) gastric cancer (GC) and HP-negative (HP-) GC are still unclear. To clarify the differences, we compared the characteristics of the two
Quim Castellví et al.
Bioelectrochemistry (Amsterdam, Netherlands), 105, 16-24 (2015-05-09)
Delivery of the so-called Tumor Treatment Fields (TTFields) has been proposed as a cancer therapy. These are low magnitude alternating electric fields at frequencies from 100 to 300 kHz which are applied continuously in a non-invasive manner. Electric field delivery
Jianhui Ma et al.
Cancer cell, 35(3), 504-518 (2019-03-05)
Ionizing radiation (IR) and chemotherapy are standard-of-care treatments for glioblastoma (GBM) patients and both result in DNA damage, however, the clinical efficacy is limited due to therapeutic resistance. We identified a mechanism of such resistance mediated by phosphorylation of PTEN
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU065891-20UG | 04061828616169 |
| EHU065891-50UG | 04061828383450 |