Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCGAATGGGGGGGGAGGCACCCGAGCTGGCCCTGGACCCGGTGCCTCAGGATGCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGCATCGGGGACGAACTGGACAGTAACATGGAGCTGCAGAGGATGATTGCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTGGTGCTCAAGGCTGGCGTGAAATGGCGTGATCTGGGCTCACTGCAACCTCTGCCTCCTGGGTTCAAGCGATTCACCTGCCTCAGCATCCCAAGGAGCTGGGATTACAGGCCCTGTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACATTGGACTTCCTCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ilaria Penna et al.
Oncotarget, 7(4), 3947-3965 (2015-12-19)
Intrinsic cross-resistance to inhibition of different signaling pathways may hamper development of combinatorial treatments in melanoma, but the relative frequency of this phenotype and the strategies to overcome this hurdle remain poorly understood. Among 49 BRAF-mutant melanoma cell lines from
Li-han Zhang et al.
Apoptosis : an international journal on programmed cell death, 21(4), 473-488 (2016-01-16)
Epirubicin (EPI) is widely used for triple negative breast cancer (TNBC), but a substantial number of patients develop EPI resistance that is associated with poor outcome. The underlying mechanism for EPI resistance remains poorly understood. We have developed and characterized
Chia-Hui Huang et al.
Toxicology and applied pharmacology, 334, 35-46 (2017-09-05)
Quinacrine, which is clinically used as an antimalarial drug, has anti-cancer activity. However, mechanism underlying its cytotoxic effect remains to be completely elucidated. In the present study, we investigated the cytotoxic effect of quinacrine on human leukemia U937 cells. Quinacrine-induced
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU069421-20UG | 04061828609314 |
| EHU069421-50UG | 04061828386109 |