Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AACAAGTCGGCTGTGGAGATGCGGAAAGCCCTGACGGACTTCATTCAAGAGGAATTCCAGCATCTGAAGACTCAGGCAGAGCAGCTCCACAACCACCTCCAGCCTGGGAGATAGGCCTTGCTTGCTGCCTTCTGGATTCTTGGCCCGCACAGAGCTGGGGCTGAGGGATGGACTGATGCTTTTAGCTCAAACGTGGCTTTTAGACAGATTTGTTCATAGACCCTCTCAAGTGCCCTCTCCGAGCTGGTAGGCATTCCAGCTCCTCCGTGCTTCCTCAGTTACACAAAGGACCTCAGCTGCTTCTCCCACTTGGCCAAGCAGGGAGGAAGAAGCTTAGGCAGGGCTCTCTTTCCTTCTTGCCTTCAGATGTTCTCTCCCAGGGGCTGGCTTCAGGAGGGAGCATAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wenguang Chang et al.
Molecular nutrition & food research, 63(7), e1801322-e1801322 (2019-01-12)
High fat (HF)-diet-induced insulin resistance is a major contributor to the pathogenesis of cardiovascular diseases. However, the molecular mechanisms that regulate cardiac insulin signaling are not fully understood. The regulatory role of tafazzin in the hearts of HF-diet-fed mice is
Libo Yan et al.
Archives of biochemistry and biophysics, 562, 31-36 (2014-08-01)
The Hippo-YAP pathway is altered and implicated as an oncogenic signaling pathway in many human cancers. Hypoxia is an important microenvironmental factor that promotes tumorigenesis. However, the effects of hypoxia on the two most important Hippo-YAP effectors, YAP (Yes-associated protein)
M Shanzer et al.
Oncogene, 34(32), 4190-4198 (2014-11-05)
The polyomavirus middle T antigen (PyMT) is an oncogene that activates the non-receptor tyrosine kinase, c-Src, and physically interacts with Taz (WWTR1). Taz is a pro-oncogenic transcription coactivator of the Tead transcription factors. The Hippo tumor suppressor pathway activates the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU076701-20UG | 04061831353471 |
| EHU076701-50UG | 04061831373073 |