Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAATTAAAAGGAGAAAAAATACAATTTCTCACTTTGCATTTAGTCAAAAGAAAAAATGCTTTATAGCAAAATGAAAGAGAACATGAAATGCTTCTTTCTCAGTTTATTGGTTGAATGTGTATCTATTTGAGTCTGGAAATAACTAATGTGTTTGATAATTAGTTTAGTTTGTGGCTTCATGGAAACTCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Beibei Zhang et al.
Experimental and therapeutic medicine, 20(4), 3633-3642 (2020-08-29)
The metastatic behavior of hepatocellular carcinoma (HCC) is one of the key factors that leads to poor prognosis. The aim of the current study was to determine the changes in metastasis and the proliferation potential of bone marrow mesenchymal stem
Sheng-Li Hu et al.
Molecular neurobiology, 52(1), 236-243 (2014-08-26)
Neurosurgical operations may result in surgical injury which would lead to postoperative neurological deficits. Hyperbaric oxygen preconditioning (HBO-PC) may be beneficial for such people. However, the exact mechanism underlying HBO-PC is not well known yet. The aim of this study
Iman A Mohamed et al.
PloS one, 10(4), e0123318-e0123318 (2015-04-18)
Enhanced expression and activity of the Na+/H+ exchanger isoform 1 (NHE1) has been implicated in cardiomyocyte hypertrophy in various experimental models. The upregulation of NHE1 was correlated with an increase in osteopontin (OPN) expression in models of cardiac hypertrophy (CH)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU077661-50UG | 04061828401161 |
| EHU077661-20UG | 04061828628803 |