Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACCAAGGCACCAAGATGATACCCTGTGACTTCCTCATCCCGGTCCAGACCCAGCACCCCATACGGAAGGGTCTGCATCACAAGATCCTCCTGGCCAACTTCTTGGCCCAGACAGAGGCCCTGATGAGGGGAAAATCGACGGAGGAGGCCCGAAAGGAGCTCCAGGCTGCGGGCAAGAGTCCAGAGGACCTTGAGAGGCTGCTGCCACATAAGGTCTTTGAAGGAAATCGCCCAACCAACTCTATTGTGTTCACCAAGCTCACACCATTCATGCTTGGAGCCTTGGTCGCCATGTATGAGCACAAGATCTTCGTTCAGGGCATCATCTGGGACATCAACAGCTTTGACCAGTGGGGAGTGGAGCTGGGAAAGCAGCTGGCTAAGAAAATAGAGCCTGAGCTTGATGGCAGTGCTCAAGTGACCTCTCACGACGCTTCTACC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yiran Li et al.
International journal of oncology, 47(3), 1017-1024 (2015-07-24)
Autocrine motility factor (AMF) as a cytokine and a growth factor, is known to regulate tumor cell growth and motility in the progress of various human malignant tumors, however, its role in endometrial cancer (EC) has not been fully studied.
Ming Zong et al.
Arthritis research & therapy, 17, 100-100 (2015-04-19)
Fibroblast-like synoviocytes (FLS) play an important role in the pathogenesis of rheumatoid arthritis (RA). This study aimed to investigate the role of glucose 6-phosphate isomerase (GPI) in the proliferation of RA-FLS. The distribution of GPI in synovial tissues from RA
Dongling Zou et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6725-6732 (2015-04-03)
Chemotherapy is the preferred therapeutic approach for the therapy of advanced ovarian cancer, but 5-year survival rate remains low due to the development of drug resistance. Increasing evidence has documented that microRNAs (miRNAs) act important roles in drug resistance in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU078901-50UG | 04061828402359 |
| EHU078901-20UG | 04061831363265 |