Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTATCAGAAAGCCCCAAGCAATTGCTGCATCTTAGTAGGGTGAGGGATAAGCAAAAGAGGATGTTCACCATAACCCAGGAATGAAGATACCATCAGCAAAGAATTTCAATTTGTTCAGTCTTTCATTTAGAGCTAGTCTTTCACAGTACCATCTGAATACCTCTTTGAAAGAAGGAAGACTTTACGTAGTGTAGATTTGTTTTGTGTTGTTTGAAAATATTATCTTTGTAATTATTTTTAATATGTAAGGAATGCTTGGAATATCTGCTGTATGTCAACTTTATGCAGCTTCCTTTTGAGGGACAAATTTAAAACAAACAACCCCCCATCACAAACTTAAAGGATTGCAAGGGCCAGATCTGTTAAGTGGTTTCATAGGAGACACATCCAGCAATTGTGTGGTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
So Yoon Ahn et al.
Cell transplantation, 26(1), 145-156 (2016-08-19)
Mesenchymal stem cell (MSC) transplantation protects against neonatal severe intraventricular hemorrhage (IVH)-induced brain injury by a paracrine rather than regenerative mechanism; however, the paracrine factors involved and their roles have not yet been delineated. This study aimed to identify the
Chun-Yan Sun et al.
Oncology reports, 37(5), 2751-2760 (2017-04-14)
Brain-derived neurotrophic factor (BDNF) is expressed in a number of neural and non-neuronal tumors. The present study investigated the effect of endogenous BDNF on the biological behavior of cervix cancer cells using small interfering RNA (siRNA). HeLa, a cervix cancer
Abdelrahman Y Fouda et al.
Molecular neurobiology, 54(1), 661-670 (2016-01-14)
Angiotensin type 1 receptor blockers (ARBs) have been shown to be neuroprotective and neurorestorative in experimental stroke. The mechanisms proposed include anti-inflammatory, antiapoptotic effects, as well as stimulation of endogenous trophic factors leading to angiogenesis and neuroplasticity. We aimed to
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU081321-20UG | 04061828631865 |
| EHU081321-50UG | 04061828404568 |