Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TATTTGGGCCAAGGTGTTTCCATTTCTCAATCAGTGCAGTGATACATGTACTCCAGAGGGACAGGGTGGACCCCCTGAGTCAACTGGAGCAAGAAGGAAGGAGGCAGACTGATGGCGATTCCCTCTCACCCGGGACTCTCCCCCTTTCAAGGAAAGTGAACCTTTAAAGTAAAGGCCTCATCTCCTTTATTGCAGTTCAAATCCTCACCATCCACAGCAAGATGAATTTTATCAGCCATGTTTGGTTGTAAATGCTCGTGTGATTTCCTACAGAAATACTGCTCTGAATATTTTGTAATAAAGGTCTTTGCACATGTGACCACATACGTGTTAGGAGGCTGCATGCTCTGGAAGCCTGGACTCTAAGCTGGAGCTCTTGGAAGAGCTCTTCGGTTTCTGAGCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yumei Yan et al.
Scientific reports, 6, 37052-37052 (2016-11-16)
Hepatocellular carcinoma (HCC) is refractory to chemotherapies, necessitating novel effective agents. The lysosome inhibitor Bafilomycin A1 (BafA1) at high concentrations displays cytotoxicity in a variety of cancers. Here we show that BafA1 at nanomolar concentrations suppresses HCC cell growth in
Alisertib promotes apoptosis and autophagy in melanoma through p38 MAPK-mediated aurora a signaling.
Yuan-Yuan Shang et al.
Oncotarget, 8(63), 107076-107088 (2018-01-02)
We investigated the efficacy of Alisertib (ALS), a selective Aurora kinase A (AURKA) inhibitor, in melanoma. We found that ALS exerts anti-proliferative, pro-apoptotic, and pro-autophagic effects on A375 and skmel-5 melanoma cells by inhibiting p38 MAPK signaling. SB202190, a p38
Wan-Juan Song et al.
Pathology, research and practice, 213(10), 1282-1288 (2017-09-17)
This study was to identify the biomarkers for the malignancy and poor prognosis in patients with ovarian cancer. The protein expression of p38MAPK family isoform p38α (p38α) and activating transcription factor 2 (ATF2) was measured in 120 ovarian serous adenocarcinomas
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU081441-20UG | 04061831353945 |
| EHU081441-50UG | 04061828404674 |