Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTGTCTCTGCATCCATTTGAACACATTATTAAGCACCGATAATAGGTAGCCTGCTGTGGGGTATACAGCATTGACTCAGATATAGATCCTGAGCTCACAGAGTTTATAGTTAAAAAAACAAACAGAAACACAAACGATTTGGATCAAAAGGAGAAATGATAAGTGACAAAAGCAGCACAAGGAATTTCCCTGTGTGGATGCTGAGCTGTGATGGCGGGCACTGGGTACCCAAGTGAAGGTTCCCAAGGACATGAGTCTGTAGGAGCAAGGGCACAAACTGCAGCTGTGAGTGCGTGTGTGTGATTTGGTGTAGGTAGGTCTGTTTGCCACTTGATGGGGCCTGGGTTTGTTCCTGGGGCTGGAATGCTGGGTATGCTCTGTGACAAGGCTACGCTGACAATCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yan Chen et al.
Cancer medicine, 5(12), 3564-3571 (2016-11-24)
Cytochrome P450 2C8 (CYP2C8) is one of the enzymes that primarily participate in producing metabolisms of medications and P-glycoprotein (P-gp) has been regarded as one of the important molecules in chemotherapeutically induced multidrug resistance (MDR). In addition, the pregnane X
Omozuanvbo Aisiku et al.
Blood, 125(12), 1976-1985 (2015-01-15)
Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein
Liming Chen et al.
Molecular pharmacology, 94(1), 749-759 (2018-04-25)
Cytochrome P450 (P450) enzymes are responsible for metabolizing drugs. Expression of P450s can directly affect drug metabolism, resulting in various outcomes in therapeutic efficacy and adverse effects. Several nuclear receptors are transcription factors that can regulate expression of P450s at
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU081471-50UG | 04061828404704 |
| EHU081471-20UG | 04061828631926 |