Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTCCTGGATGCTGGTTATGGAGATGGCAGAACTTGGTCCCCTCAATAAGTATTTGCAGCAGAACAGACATGTCAAGGATAAGAACATCATAGAACTGGTTCATCAGGTTTCCATGGGCATGAAGTACTTGGAGGAGAGCAATTTTGTGCACAGAGATCTGGCTGCAAGAAATGTGTTGCTAGTTACCCAACATTACGCCAAGATCAGTGATTTCGGACTTTCCAAAGCACTGCGTGCTGATGAAAACTACTACAAGGCCCAGACCCATGGAAAGTGGCCTGTCAAGTGGTACGCTCCGGAATGCATCAACTACTACAAGTTCTCCAGCAAAAGCGATGTCTGGAGCTTTGGAGTGTTGATGTGGGAAGCATTCTCCTATGGGCAGAAGCCATATCGAGGGATGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Morgan Black et al.
Oral oncology, 101, 104529-104529 (2019-12-23)
Spleen tyrosine kinase (SYK) is a promoter of cell survival in a variety of cell types, including normal and cancerous epithelial cells. We hypothesized that SYK would an important therapeutic target to inhibit for the treatment of HNSCC. SYK protein
Pan Gao et al.
Oncotarget, 8(48), 83900-83912 (2017-11-16)
Spleen tyrosine kinase (SYK), a non-receptor cytoplasmic tyrosine enzyme, is well known for its ability in certain pathways through immune receptors. Recently
George E Duran et al.
PloS one, 14(1), e0210879-e0210879 (2019-01-23)
In a previously published study, higher levels of spleen tyrosine kinase (Syk) were observed in recurrent post-chemotherapy ovarian cancers compared to primary tumors. Syk inhibition was found to stabilize microtubules and potentiate paclitaxel activity in cellular models of taxane-resistant ovarian
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU081641-20UG | 04061828632039 |
| EHU081641-50UG | 04061831373479 |