Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACCTCAAAGCGAGCACATATGCTGATTGACATGCACTTTCGGAGTCTGCGCACTAAGTTGTCTCTGATAATGAGAAATGAAGAAGCTAGTAAGCAGCTGGAGAGTTCAAGGCAGCTTGCCTCGAGATTTCATGAACAGTTTATCGTAAGAGAAGATCTGATGGGTCTAGCTATTGGTACTCATGGTGCTAATATTCAGCAAGCTAGAAAAGTACCTGGGGTCACTGCTATTGATCTAGATGAAGATACCTGCACATTTCATATTTATGGAGAGGATCAGGATGCAGTGAAAAAAGCTAGAAGCTTTCTCGAATTTGCTGAAGATGTAATACAAGTTCCAAGGAACTTAGTAGGCAAAGTAATAGGAAAAAATGGAAAGCTGATTCAGGAGATTGTGGACAAGTCAGGAGTTGTGAGGGTGAGGATTGAGGCTGAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Muzammil Ahmad et al.
Nucleic acids research, 44(13), 6335-6349 (2016-06-04)
DNA Topoisomerases are essential to resolve topological problems during DNA metabolism in all species. However, the prevalence and function of RNA topoisomerases remain uncertain. Here, we show that RNA topoisomerase activity is prevalent in Type IA topoisomerases from bacteria, archaea
Veronica Nobile et al.
Human genetics, 139(2), 227-245 (2020-01-11)
Fragile X-related disorders are due to a dynamic mutation of the CGG repeat at the 5' UTR of the FMR1 gene, coding for the RNA-binding protein FMRP. As the CGG sequence expands from premutation (PM, 56-200 CGGs) to full mutation
Laurent Ferron et al.
Neurobiology of disease, 138, 104779-104779 (2020-01-29)
Fragile X syndrome (FXS), the most common form of inherited intellectual disability and autism, results from the loss of fragile X mental retardation protein (FMRP). We have recently identified a direct interaction of FMRP with voltage-gated Ca2+ channels that modulates
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU082131-20UG | 04061831354126 |
| EHU082131-50UG | 04061828393947 |