Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGAGAGAGAGAATGGGAACGGGAAGTGCTGGGCATAAAGCGAGACAAGAGTGACAGCCCTGCCATTCAGCTACGTCTCAAAGAACCTATGGATGTTGATGTAGAAGATTATTACCCAGCTTTCCTGGACATGGTGCGGAGCCTGCTGGATGGCAACATAGACTCATCACAGTATGAAGATTCACTGAGAGAGATGTTCACCATTCATGCCTACATTGCCTTTACCATGGACAAACTGATCCAGAGCATTGTCAGACAGCTGCAGCATATCGTGAGTGATGAGATCTGTGTGCAGGTGACTGACCTTTACCTGGCAGAAAATAATAATGGGGCCACCGGAGGCCAGCTGAACACACAGAACTCAAGGAGCCTCCTGGAGTCAACGTATCAGCGGAAAGCTGAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jie Ren et al.
Experimental and therapeutic medicine, 18(4), 2565-2573 (2019-09-27)
Previous studies have indicated that microRNA (miR)-210-3p is upregulated in NSCLC, however, the specific mechanism underlying the role of miR-210-3p in NSCLC pathogenesis requires further investigation. The aim of the present study was to explore the roles of miR-210-3p in
Giovanni Gambi et al.
Cancer research, 79(12), 3076-3087 (2019-01-30)
Epigenetic silencing of promoter and enhancer regions is a common phenomenon in malignant cells. The transcription factor STAT3 is aberrantly activated in several tumors, where its constitutive acetylation accounts for the transcriptional repression of a number of tumor suppressor genes
Sweta Srivas et al.
Journal of neurochemistry, 145(3), 204-216 (2018-03-02)
Epigenetic modifications through methylation of DNA and acetylation of histones modulate neuronal gene expression and regulate long-term memory. Earlier we demonstrated that scopolamine-induced decrease in memory consolidation is correlated with enhanced expression of hippocampal DNA methyltransferase 1 (DNMT1) and histone
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU082221-20UG | 04061831354133 |
| EHU082221-50UG | 04061831373516 |