Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGTACCAGATGGGACTGTGGTTACTGTCATGGCGGGTAACGATGAAAATTATTCTGCTGAGCTCCGGAATGCCTCTGCTGTTATGAAAAACCAAGTAGCAAGGTTCAACGATCTGAGATTTGTGGGCCGGAGTGGACGAGGCAAGAGTTTCACCTTGACCATAACCGTCTTCACAAATCCTCCCCAAGTAGCTACCTATCACAGAGCAATTAAAGTTACAGTAGATGGACCTCGGGAACCCAGAAGGCACAGACAGAAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGACCGCCTCAGTGATTTAGGGCGCATTCCTCATCCCAGTATGAGAGTAGGTGTCCCGCCTCAGAACCCACGGCCCTCCCTGAACTCTGCACCAAGTCCTTTTAATCCACAAGGACAGAGTCAGATTACAGACCCCAGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Uwe Raaz et al.
Circulation research, 117(6), 513-524 (2015-07-26)
Accelerated arterial stiffening is a major complication of diabetes mellitus with no specific therapy available to date. The present study investigates the role of the osteogenic transcription factor runt-related transcription factor 2 (Runx2) as a potential mediator and therapeutic target
Engin Kaptan et al.
Journal of cellular biochemistry, 118(11), 3911-3919 (2017-04-09)
Runx2 promotes metastatic ability of cancer cells by directly activating some of the mediators regarding malignancy. Galectin-3 (Gal-3) extensively expressed in normal and transformed cells and it is responsible for many cellular processes. In this study, we aimed to investigate
Rajnee Kanwal et al.
Cancer letters, 430, 25-33 (2018-05-19)
The role of CD133 (Prominin-1) as a cancer stem cell marker may be useful for therapeutic approaches and prognostication in prostate cancer patients. We investigated the stem-cell-related function and biological features of a subpopulation of CD133+ cells isolated from established primary
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU089751-20UG | 04061831355451 |
| EHU089751-50UG | 04061831373899 |