Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCCTCTGTAAAAAGATCCCTGAGATTATTCCTTCTTCTAGTTTTATGCGACAGCTTTACTTTAAAATTCAAGTTATACATCTTGGGAGTACAATGGCCCGACATTTCTTCATAGGTAGAAACAAATACTTGACTCAGTGATACTCATGACCATTAGAATAGTCATACCTGGAATGTGTCAAATTATAAGAGACAGACACTTGGTTAGTGGCTGCCTCATATAGCACTTTTGAAGAGGCCTAAGTCAAAACTTGCAATATAACATTCTATTGACTTTCTTAAAAATATTTTTTCTGTACCTAACTTGAGCATAAGGGTTATTTGAGCAAGTAACATTAACTCAGTGGAAGGCATTGTCCTGTGAAATATTCTTAGGCAGATCTGCCCACATCTTTATTGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MRE11(4361), MRE11A(4361)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Biochem/physiol Actions
MRE11A (meiotic recombination 11 homolog A) is a nuclease which forms complex with Rad50 (DNA repair protein) and Nbs1 (nijmegen breakage syndrome protein 1). This complex works as a sensor of DNA double strand breaks, and is involved in DNA repair processes and DNA damage response. Absence of the complex activity causes developmental and/or degenerative neuronal disorders. In homologous recombination repair, MRE11A is responsible for the 3′-to-5′ exonuclease activity, leading to the generation of protruding 3′ ssDNA at double strand breaks. MRE11A is also an oncoprotein which is associated with colorectal cancer and malignant breast cancer. Hypomorphic mutations in this gene leads to Ataxia-Telangiectasia like disorder.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Rad51 recombinase prevents Mre11 nuclease-dependent degradation and excessive PrimPol-mediated elongation of nascent DNA after UV irradiation.
Vallerga MB
Proceedings of the National Academy of Sciences of the USA, 112, E6624-E6624 (2015)
Interaction of MRE11 and Clinicopathologic Characteristics in Recurrence of Breast Cancer: Individual and Cumulated Receiver Operating Characteristic Analyses.
Yang CH
BioMed Research International, 2017, 2563910-2563910 (2017)
M Petroni et al.
Cell death and differentiation, 23(2), 197-206 (2015-06-13)
The MRE11/RAD50/NBS1 (MRN) complex is a major sensor of DNA double strand breaks, whose role in controlling faithful DNA replication and preventing replication stress is also emerging. Inactivation of the MRN complex invariably leads to developmental and/or degenerative neuronal defects
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU091361-50UG | 04061828361120 |
| EHU091361-20UG | 04061831355765 |