Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAATCCCTCATTGACGAAGAGGTAATCTACAGTGAGCTGATGAGTGACTTTGAGATGGATGAGAAGGACTTTGCAGCTGACTCTTGGAGTCTTGCTGTGGACAGCAGCTTCCTGCAGCAGCATAAAAAGGAGGTGATGAAGCAGCAAGATGTCATCTATGAGCTAATCCAGACAGAGCTGCACCATGTGAGGACACTGAAGATCATGACCCGCCTCTTCCGCACGGGGATGCTGGAAGAGCTACACTTGGAGCCAGGAGTGGTCCAGGGCCTGTTCCCCTGCGTGGACGAGCTCAGTGACATCCATACACGCTTCCTCAGCCAGCTATTAGAACGCCGACGCCAGGCCCTGTGCCCTGGCAGCACCCGGAACTTTGTCATCCATCGCTTGGGTGATCTGCTCATCAGCCAGTTCTCAGGTCCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Tony Y-C Tsai et al.
Developmental cell, 49(2), 189-205 (2019-04-25)
Efficient chemotaxis requires rapid coordination between different parts of the cell in response to changing directional cues. Here, we investigate the mechanism of front-rear coordination in chemotactic neutrophils. We find that changes in the protrusion rate at the cell front
Juan José Sáez et al.
The Journal of cell biology, 218(7), 2247-2264 (2019-06-15)
B lymphocytes capture antigens from the surface of presenting cells by forming an immune synapse. Local secretion of lysosomes, which are guided to the synaptic membrane by centrosome repositioning, can facilitate the extraction of immobilized antigens. However, the molecular basis
Nisha Bte Mohd Rafiq et al.
Nature materials, 18(6), 638-649 (2019-05-23)
The interrelationship between microtubules and the actin cytoskeleton in mechanoregulation of integrin-mediated adhesions is poorly understood. Here, we show that the effects of microtubules on two major types of cell-matrix adhesion, focal adhesions and podosomes, are mediated by KANK family
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU092941-20UG | 04061828597468 |
| EHU092941-50UG | 04061828362592 |