Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAAGGCATTTGTGGGAAGAAACACTCTGAGCAAGTCCCAGATATACTACAACTCAATGCAATCTTTAACATGTTGAATACCAAGAACTGCCCAAGTTTGAAGGACAAACCGAAGGTGATCATCATCCAGGCCTGCCGTGGTGACAGCCCTGGTGTGGTGTGGTTTAAAGATTCAGTAGGAGTTTCTGGAAACCTATCTTTACCAACTACAGAAGAGTTTGAGGATGATGCTATTAAGAAAGCCCACATAGAGAAGGATTTTATCGCTTTCTGCTCTTCCACACC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Weigang Zhang et al.
The Journal of pathology, 241(3), 392-404 (2016-11-20)
Psoriasis is an autoimmune skin disease, in which keratinocytes play a crucial pathogenic role. High-mobility group protein B1 (HMGB1) is an inflammatory factor that can be released from keratinocyte nuclei in psoriatic lesions. We aimed to investigate the proinflammatory effect
Vahid Mirshafiee et al.
ACS nano, 12(4), 3836-3852 (2018-03-16)
The liver and the mononuclear phagocyte system are a frequent target for engineered nanomaterials, either as a result of particle uptake and spread from primary exposure sites or systemic administration of therapeutic and imaging nanoparticles. In this study, we performed
Xiang Wang et al.
Small (Weinheim an der Bergstrasse, Germany), 16(21), e2000528-e2000528 (2020-04-28)
The mononuclear phagocyte system in the liver is a frequent target for nanoparticles (NPs). A toxicological profiling of metal-based NPs is performed in Kupffer cell (KC) and hepatocyte cell lines. Sixteen NPs are provided by the Nanomaterial Health Implications Research
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU097671-20UG | 04061831356809 |
| EHU097671-50UG | 04061831374292 |