Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGAGCATGAACATGGGCAGTGACTTTGACGTCTTTGCCCACATCACCAACAACACCGCTGAGGAGTACGTCTGCCGCCTCCTGCTCTGTGCCCGCACCGTCAGCTACAATGGGATCTTGGGGCCCGAGTGTGGCACCAAGTACCTGCTCAACCTCAACCTGGAGCCTTTCTCTGAGAAGAGCGTTCCTCTTTGCATCCTCTATGAGAAATACCGTGACTGCCTTACGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Robin Delaine-Smith et al.
Cancers, 11(5) (2019-05-24)
Colorectal cancer is the third most common cancer worldwide, and the fourth leading cause of malignancy-related mortality. This highlights the need to understand the processes driving this disease in order to develop new treatments and improve patient outcomes. A potential
Yesim Bagatur et al.
Cell adhesion & migration, 12(2), 138-151 (2017-05-13)
Tissue transglutaminase (TG2) is the ubiquitously expressed member of transglutaminase family and shown to play a critical role in the development and progression of drug resistance malignancies. We have previously showed the association of TG2 upregulation with progression and metastasis
Ramon L Serrano et al.
PloS one, 14(4), e0212235-e0212235 (2019-04-04)
Neointimal hyperplasia, stimulated by injury and certain vascular diseases, promotes artery obstruction and tissue ischemia. In vascular smooth muscle cell (VSMCs), multiple modulators of protein handling machinery regulate intimal hyperplasia. These include elements of the VSMC unfolded protein response to
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU100711-20UG | 04061828591350 |
| EHU100711-50UG | 04061828367313 |