Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCCCAAGCTATGAAATCAGAGGGAGGCTTCATCTGGGCCTGTAAAAACTATGATGGTGACGTGCAGTCGGACTCTGTGGCCCAAGGGTATGGCTCTCTCGGCATGATGACCAGCGTGCTGGTTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCACGGGACTGTAACCCGTCACTACCGCATGTACCAGAAAGGACAGGAGACGTCCACCAATCCCATTGCTTCCATTTTTGCCTGGACCAGAGGGTTAGCCCACAGAGCAAAGCTTGATAACAATAAAGAGCTTGCCTTCTTTGCAAATGCTTTGGAAGAAGTCTCTATTGAGACAATTGAGGCTGGCTTCATGACCAAGGACTTGGCTGCTTGCATTAAAGGTTTACCCAATGTGCAACGTTCTGAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Daniel R Wahl et al.
Cancer research, 77(4), 960-970 (2016-12-08)
NADPH is a critical reductant needed in cancer cells to fuel the biosynthesis of deoxynucleotides and antioxidants and to sustain stress-survival responses after radiation-induced DNA damage. Thus, one rational strategy to attack cancer cells is to target their heavy reliance
Qi Wang et al.
Oncology reports, 43(1), 188-200 (2019-11-21)
Mutation of the isocitrate dehydrogenase (IDH) gene is regarded a novel indicator for the prognosis of patients with glioma. However, the role of the IDH1 gene mutations in carcinogenesis and the mechanisms underlying their function in glioblastoma multiforme (GBM) remain
Xiayi Liu et al.
Journal of cellular physiology, 234(7), 11602-11609 (2018-11-30)
DDIT3 is of great importance in endoplasmic reticulum stress and is involved in many inflammatory diseases and mineralization processes. The cementum protects teeth from periodontitis and provides attachment for Sharpey's fibers of the periodontal ligament. However, the effect of DDIT3
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU110401-50UG | 04061828369256 |
| EHU110401-20UG | 04061831358216 |