Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAAGGAAGAAGTGGGCTGAAGAATTTAATGATGAAACTAATGTGAGAGGACGATTATTTATCATTTCTACTAAAGCAGGATCTCTAGGAATTAATCTGGTAGCTGCTAATCGAGTAATTATATTCGACGCTTCTTGGAATCCATCTTATGACATCCAGAGTATATTCAGAGTTTATCGCTTTGGACAAACTAAGCCTGTTTATGTATATAGGTTCTTAGCTCAGGGAACCATGGAAGATAAGATTTATGATCGGCAAGTAACTAAGCAGTCACTGTCTTTTCGAGTTGTTGATCAGCAGCAGGTGGAGCGTCATTTTACTATGAATGAGCTTACTGAACTTTATACTTTTGAGCCAGACTTATTAGATGACCCTAATTCAGAAAAGAAGAAGAAGAGGGATACTCCCATGCTGCCAAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jaewon Min et al.
Nucleic acids research, 45(5), 2615-2628 (2017-01-14)
Alternative lengthening of telomeres (ALT) is a telomerase independent telomere maintenance mechanism that occurs in ∼15% of cancers. The potential mechanism of ALT is homology-directed telomere synthesis, but molecular mechanisms of how ALT maintains telomere length in human cancer is
Manav Pathania et al.
Cancer cell, 32(5), 684-700 (2017-11-07)
Gain-of-function mutations in histone 3 (H3) variants are found in a substantial proportion of pediatric high-grade gliomas (pHGG), often in association with TP53 loss and platelet-derived growth factor receptor alpha (PDGFRA) amplification. Here, we describe a somatic mouse model wherein
Jennifer M Mason et al.
Cancer research, 74(13), 3546-3555 (2014-04-23)
RAD51 is the central protein that catalyzes DNA repair via homologous recombination, a process that ensures genomic stability. RAD51 protein is commonly expressed at high levels in cancer cells relative to their noncancerous precursors. High levels of RAD51 expression can
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU112941-20UG | 04061828633227 |
| EHU112941-50UG | 04061828406180 |