Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGGGTGACAGAGATAGCCAATGGCTCCAAGGATGGCTTGGATTCCAACCCTATGAAGGATTACATGATCCTGAGTGGTCCCCAGAAGACAGCTGTTGCTGTGTTGTGCACTCTTCTGGGCCTGCTAAGTGCCCTGGAGAACGTGGCTGTGCTCTATCTGATCCTGTCCTCCCACCAACTCCGCCGGAAGCCCTCATACCTGTTCATTGGCAGCTTGGCTGGGGCTGACTTCCTGGCCAGTGTGGTCTTTGCATGCAGCTTTGTGAATTTCCATGTTTTCCATGGTGTGGATTCCAAGGCTGTCTTCCTGCTGAAGATTGGCAGCGTGACTATGACCTTCACAGCCTCTGTGGGTAGCCTCCTGCTGACCGCCATTGACCGATACCTCTGCCTGCGCTATCCACCTTCCTACAAAGCTCTGCTCACCCGTGGAAGGGCACTGGTGACCCTGGGCATCATGTGGGTCCTCTCAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Young Sun Hwang et al.
Chemico-biological interactions, 273, 107-114 (2017-06-12)
Melanogenesis plays a critical role in the protection of skin against external stresses such as ultraviolet irradiation and oxidative stressors. This study was aimed to investigate the effects of cannabidiol on melanogenesis and its mechanisms of action in human epidermal
Sabrina Fechtner et al.
Clinical and experimental rheumatology, 37(6), 1026-1035 (2019-04-04)
Recent studies showed that the expression of cannabinoid receptor 2 (CB2), not CB1, is upregulated at both the mRNA and protein levels in rheumatoid arthritis synovial fibroblasts (RASFs), however, little is known about its endogenous role in pro-inflammatory cytokine signalling
Sabrina Fechtner et al.
Frontiers in immunology, 10, 1027-1027 (2019-05-30)
Management of pain in the treatment of rheumatoid arthritis (RA) is a priority that is not fully addressed by the conventional therapies. In the present study, we evaluated the efficacy of cannabinoid receptor 2 (CB2) agonist JWH-015 using RA synovial
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU120781-20UG | 04061828581443 |
| EHU120781-50UG | 04061828346646 |