Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTTTCTCCGGCAAGTACCAACTGCAGAGCCAGGAAAACTTTGAAGCCTTCATGAAGGCAATCGGTCTGCCGGAAGAGCTCATCCAGAAGGGGAAGGATATCAAGGGGGTGTCGGAAATCGTGCAGAATGGGAAGCACTTCAAGTTCACCATCACCGCTGGGTCCAAAGTGATCCAAAACGAATTCACGGTGGGGGAGGAATGTGAGCTGGAGACAATGACAGGGGAGAAAGTCAAGACAGTGGTTCAGTTGGAAGGTGACAATAAACTGGTGACAACTTTCAAAAACATCAAGTCTGTGACCGAACTCAACGGCGACATAATCACCAATACCATGACATTGGGTGACATT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yujuan Wang et al.
PloS one, 14(4), e0214144-e0214144 (2019-04-23)
Castration is an important means of improving the beef quality via increasing fat deposition. However, little is known about the molecular mechanism underlying the fat deposition after castration. Here, the intramuscular fat (IMF) content of the steer group was shown
Yufei Chen et al.
Journal of pharmacy & pharmaceutical sciences : a publication of the Canadian Society for Pharmaceutical Sciences, Societe canadienne des sciences pharmaceutiques, 20(0), 239-251 (2017-08-16)
To investigate the effect of clofibrate on inducing liver fatty acid binding protein (FABP1) following a high-fat load in a hepatocyte cell culture model. Rat hepatoma cells (CRL-1548) were treated with a fatty acid (FA) mixture consisting of oleate:palmitate (2:1)
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU122491-20UG | 04061828593316 |
| EHU122491-50UG | 04061831375077 |