Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGTGCAGCTGTTTCCAGAGCATTGAATTACTAAAATCTCGCCCGGCTCATTTGGCTGTTTTCTTACACCATGTAGTTTCACAATTTGACCCTGCGACTTTGCTCTGTTATCTCTATTCAGACCTGTATAAACATACCAATTCCAAAGAAACTCGTCGCATCTTCCTTGAGTTTCATCAGTTCTTTCTAGATCGATCAGCACACCTGAAAGTTTCTGTTCCTGATGAAATGTCTGCAGATCTAGAAAAGAGAAGACCTGAGCTCATTCCTGAGGATCTGCATCGCCACTATATCCAAACTATGCAAGAAAGAGTCCATCCAGAAGTTCAAAGGCACTTAGAAGATTTTCGGCAGAAACGTAGTATGGGACTGACCTTGGCTGAAAGCGAGCTGACTAAACTTGATGCAGAGCGAGACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Anil Prasad et al.
Scientific reports, 7, 40648-40648 (2017-01-18)
DC-SIGN is a dendritic cell surface structure which participates in binding and transmission of HIV-1. Here, for the first time we demonstrate that cocaine induces over expression of DC-SIGN and significantly enhances virus transfer from DCs to T-cells by increasing
Wei-Chiao Chiu et al.
International journal of nanomedicine, 7, 5929-5939 (2012-12-13)
Studies to explore angiotensin II (Ang II) and its downstream signaling pathways via Rho guanine nucleotide exchange factors (RhoGEFs) and RhoA signaling are crucial to understanding the mechanisms of smooth muscle contraction leading to hypertension. This study aimed to investigate
Katsuhiko Hata et al.
The Journal of cell biology, 184(5), 737-750 (2009-03-11)
Neuronal axons are guided by attractive and repulsive cues in their local environment. Because the repulsive guidance molecule A (RGMa) was originally identified as an axon repellent in the visual system, diverse functions in the developing and adult central nervous
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU122711-20UG | 04061831359237 |
| EHU122711-50UG | 04061828356713 |