Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCAGCCAAACTGTCTTTGTCACCACGTGGGGCTCACTTTTCATCCTTCCCCAACTTCCCTAGTCCCCGTACTAGGTTGGACAGCCCCCTTCGGTTACAGGAAGGCAGGAGGGGTGAGTCCCCTACTCCCTCTTCACTGTGGCCACAGCCCCCTTGCCCTCCGCCTGGGATCTGAGTACATATTGTGGTGATGGAGATGCAGTCACTTATTGTCCAGGTGAGGCCCAAGAGCCCTGTGGCCGCCACCTGAGGTGGGCTGGGGCTGCTCCCCTAACCCTACTTTGCTTCCGCCACTCAGCCATTTCCCCCTCCTCAGATGGGGCACCAATAACAAGGAGCTCACCCTGCCCGCTCCCAACCCCCCTCCTGCTCCTCCCTGCCCCCCAAGGTTCTGGTTCCATTTTTCCTCTGTTCACAAACTACCTCTGGACAGTTGTGTTGTTTTTTGTTCAATGTTCCATTCTTCGACATCCGTCATTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Dae Kyoung Kim et al.
Experimental & molecular medicine, 48, e255-e255 (2016-08-27)
Cancer stem cells are a subpopulation of cancer cells characterized by self-renewal ability, tumorigenesis and drug resistance. The aim of this study was to investigate the role of HMGA1, a chromatin remodeling factor abundantly expressed in many different cancers, in
Liqian Zhu et al.
Virus research, 238, 236-242 (2017-07-08)
Bovine herpesvirus 1 (BoHV-1) is an important pathogen of cattle that causes clinical symptoms in the upper respiratory tract and conjunctivitis. Like most alpha-herpesvirinae subfamily members, BoHV-1 establishes latency in sensory neurons. Stress consistently induces reactivation from latency, which is
Satish Sati et al.
Molecular cell, 78(3), 522-538 (2020-03-30)
To understand the role of the extensive senescence-associated 3D genome reorganization, we generated genome-wide chromatin interaction maps, epigenome, replication-timing, whole-genome bisulfite sequencing, and gene expression profiles from cells entering replicative senescence (RS) or upon oncogene-induced senescence (OIS). We identify senescence-associated heterochromatin
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU122721-20UG | 04061831359244 |
| EHU122721-50UG | 04061828356720 |