Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTTCGACTTGCGTGTGATGTTGATCAGGTGACAAGGCAACTGTATGAGCCACTAGTTATGCAGCTGATTCACTGGTTCACTAACAACAAGAAATTTGAAAGTCAGGATACTGTTGCCTTACTAGAAGCTATATTGGATGGAATTGTGGACCCTGTTGACAGTACTTTAAGAGATTTTTGTGGTCGGTGTATTCGAGAATTCCTTAAATGGTCCATTAAGCAAATAACACCACAGCAGCAGGAGAAGAGTCCAGTAAACACCAAATCGCTTTTCAAGCGACTTTATAGCCTTGCGCTTCACCCCAATGCTTTCAAGAGGCTGGGAGCATCACTTGCCTTTAATAATATCTACAGGGAATTCAGGGAAGAAGAGTCTCTGGTGGAACAGTTTGTGTTTGAAGCCTTGGTGATATACATGGAGAGTCTGGCCTTAGCACATGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shuai Li et al.
The FEBS journal, 286(12), 2341-2354 (2019-03-27)
Synthetic biology employs engineering principles to redesign biological systems for biomedical or industrial purposes. Innovation and application of original biological parts for genetic circuit construction will significantly facilitate and expedite the development of synthetic biology. Here, we built two- or
E Dickreuter et al.
Oncogene, 35(11), 1353-1362 (2015-06-16)
β1 Integrin-mediated cell-extracellular matrix interactions allow cancer cell survival and confer therapy resistance. It was shown that inhibition of β1 integrins sensitizes cells to radiotherapy. Here, we examined the impact of β1 integrin targeting on the repair of radiation-induced DNA
Lin Jia et al.
The Journal of pathology, 243(2), 255-266 (2017-08-05)
Endostatin was discovered as an endogenous angiogenesis inhibitor with broad-spectrum antitumour activities. Although clinical efficacy was observed when endostatin was combined with standard chemotherapy for non-small cell lung cancer (NSCLC), as well as other cancer types, the specific mechanisms underlying
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU123791-20UG | 04061831359435 |
| EHU123791-50UG | 04061828357680 |