Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAATGACCTCTCCATCGTCAACCCTGCTCGCAAGGGCCTCTACGAGGGCACTGGCCGGCTCTTCTTTGAGTTCTACCGCCTCCTGCATGATGCGCGGCCCAAGGAGGGAGATGATCGCCCCTTCTTCTGGCTCTTTGAGAATGTGGTGGCCATGGGCGTTAGTGACAAGAGGGACATCTCGCGATTTCTCGAGTCCAACCCTGTGATGATTGATGCCAAAGAAGTGTCAGCTGCACACAGGGCCCGCTACTTCTGGGGTAACCTTCCCGGTATGAACAGGCCGTTGGCATCCACTGTGAATGATAAGCTGGAGCTGCAGGAGTGTCTGGAGCATGGCAGGATAGCCAAGTTCAGCAAAGTGAGGACCATTACTACGAGGTCAAACTCCATAAAGCAGGGCAAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yu Nomura et al.
Cells, tissues, organs, 207(3-4), 115-126 (2019-10-02)
Stem cells have essential applications in in vitro tissue engineering or regenerative medicine. However, there is still a need to understand more deeply the mechanisms of stem cell differentiation and to optimize the methods to control stem cell function. In
Phillip L Palmbos et al.
Cancer research, 75(23), 5155-5166 (2015-10-17)
Bladder cancer is a common and deadly malignancy but its treatment has advanced little due to poor understanding of the factors and pathways that promote disease. ATDC/TRIM29 is a highly expressed gene in several lethal tumor types, including bladder tumors
Gonca Bayraktar et al.
Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology, 45(12), 2120-2130 (2020-07-30)
DNA methylation is a crucial epigenetic mark for activity-dependent gene expression in neurons. Very little is known about how synaptic signals impact promoter methylation in neuronal nuclei. In this study we show that protein levels of the principal de novo
Global Trade Item Number
| SKU | GTIN |
|---|---|
| 126985-5G | 04061838724557 |
| EHU123831-50UG | 04061828357727 |
| EHU123831-20UG | 04061828583089 |