Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGACGACTCCGTGTTTGCCCACGACCTGCTGGCCACTGGTCCCCAACAATGTGAGGGGTCCCTAGCAGCCCACCCTGCTGCTGGTGCACAGCCACTCCCCGGCATGAGACTCAGTGCAGATGGAGAGACAGCTACACAGAGCTTTGGTCTGTGTGTGTGTGTGTGCTGTGTGTGTGTGTGCACATCCGCGTGTGCCTGTGTGCGTGCGCATCTTGCCTCCAGGTGCAGAGGTACCCTGGGTGTCCCCGCTGCTGTGCAACGGTCTCCTGACTGGTGCTGCAGCACCGAGGGGCCTTTGTTCTGGGGGGACCCAGTGCAGAATGTAAGTGGGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FGFR3(2261)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
V Tassinari et al.
Cell death & disease, 6, e1688-e1688 (2015-03-15)
Both fibroblast growth factor 9 (Fgf9) and Kit Ligand (Kl) signal through tyrosine kinase receptors, yet they exert opposite effects on meiotic differentiation in postnatal spermatogonia, Fgf9 acting as a meiosis-inhibiting substance and Kl acting as a promoter of the
Xiufeng Jiang et al.
Oncotarget, 6(14), 12340-12356 (2015-04-22)
Sorafenib, an oral multikinase inhibitor of Raf, VEGF and PDGF receptor signaling is approved for advanced hepatocellular carcinoma (HCC). One strategy to improve HCC therapy is to combine agents that target key signaling pathways. Aberrant mesenchymal-epithelial transition factor (c-Met) activation
Jing Yang et al.
Cell cycle (Georgetown, Tex.), 14(20), 3318-3330 (2015-09-18)
Fibroblast growth factors (FGF1, FGF2 and FGF4) and fibroblast growth factor receptors (FGFR1, FGFR2, FGFR3 and FGFR4) have been reported to be expressed in preimplantation embryos and be required for their development. However, the functions of these molecules in trophectoderm
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU124671-20UG | 04061828583713 |
| EHU124671-50UG | 04061831375145 |