Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTGGACCATGAAGACCAGATTGCTTTGCTGAAAGGGTCTGCGGTTGAAGCTATGTTCCTTCGTTCAGCTGAGATTTTCAATAAGAAACTTCCGTCTGGGCATTCTGACCTATTGGAAGAAAGAATTCGAAATAGTGGTATCTCTGATGAATATATAACACCTATGTTTAGTTTTTATAAAAGTATTGGGGAACTGAAAATGACTCAAGAGGAGTATGCTCTGCTTACAGCAATTGTTATCCTGTCTCCAGATAGACAATACATAAAGGATAGAGAGGCAGTAGAGAAGCTTCAGGAGCCACTTCTTGATGTGCTACAAAAGTTGTGTAAGATTCACCAGCCTGAAAATCCTCAACACTTTGCCTGTCTCCTGGGTCGCCTGACTGAATTACGGACATTCAATCATCACCACGCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hai Hu et al.
Oncotarget, 8(20), 33265-33275 (2017-04-13)
Bile acids (BAs) was critical in the initiation and progression of various tumors. However, their prognostic significance in pancreatic cancer was still illusive. In the present study, the expression and biological significance of FXR, a major receptor of BAs, in
Wenxuan Xu et al.
Toxicology and applied pharmacology, 315, 23-34 (2016-12-13)
Alcoholic liver disease (ALD) is a common etiology of liver diseases, characterized by hepatic steatosis. We previously identified farnesoid X receptor (FXR) as a potential therapeutic target for ALD. Dihydroartemisinin (DHA) has been recently identified to possess potent pharmacological activities
Renchao Dong et al.
European journal of pharmacology, 857, 172461-172461 (2019-06-21)
Estrogen-induced cholestasis is a common etiology of hepatic diseases in women with contraceptives administration, pregnancy or hormone replacement therapy. Farnesoid X receptor (FXR) is a member of nuclear receptor super family of ligand-activated transcription factors that is highly expressed in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU133161-20UG | 04061828684755 |
| EHU133161-50UG | 04061828459827 |