Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
N Balaguer et al.
Molecular human reproduction, 24(8), 411-425 (2018-05-31)
Is there a specific mechanism to load the microRNA (miRNA), hsa-miR-30d, into exosomes to facilitate maternal communication with preimplantation embryos? The heterogeneous nuclear ribonucleoprotein C1 (hnRNPC1) is involved in the internalization of endometrial miR-30d into exosomes to prepare for its
Zuzana Cieniková et al.
RNA (New York, N.Y.), 21(11), 1931-1942 (2015-09-16)
The human hnRNP C is a ubiquitous cellular protein involved in mRNA maturation. Recently, we have shown that this protein specifically recognizes uridine (U) pentamers through its single RNA recognition motif (RRM). However, a large fraction of natural RNA targets
Na Li et al.
Nature cell biology, 16(11), 1080-1091 (2014-10-27)
Cyclin C was cloned as a growth-promoting G1 cyclin, and was also shown to regulate gene transcription. Here we report that in vivo cyclin C acts as a haploinsufficient tumour suppressor, by controlling Notch1 oncogene levels. Cyclin C activates an
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU133931-20UG | 04061831364378 |
| EHU133931-50UG | 04061831375558 |