Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCTTCAGAACCCACAGAGATCCGTCCACAAAAGCGGAAAAAGGGGCCAGCCCCCAAAATGCTGGGGAACGAGCTATGCAGCGTGTGTGGGGACAAGGCCTCGGGCTTCCACTACAATGTTCTGAGCTGCGAGGGCTGCAAGGGATTCTTCCGCCGCAGCGTCATCAAGGGAGCGCACTACATCTGCCACAGTGGCGGCCACTGCCCCATGGACACCTACATGCGTCGCAAGTGCCAGGAGTGTCGGCTTCGCAAATGCCGTCAGGCTGGCATGCGGGAGGAGTGTGTCCTGTCAGAAGAACAGATCCGCCTGAAGAAACTGAAGCGGCAAGAGGAGGAACAGGCTCATGCCACATCCTTGCCCCCCAGGGCTTCCTCACCCCCCCAAATCCTGCCCCAGCTCAGCCCGGAACAACTGGGCATGATCGAGAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Akihiro Shimada et al.
Lipids in health and disease, 15, 57-57 (2016-03-18)
Statins decrease cholesteryl ester transfer protein (CETP) levels, which have been positively associated with hepatic lipid content as well as serum low density lipoproteins-cholesterol (LDL-C) levels. However, the relationship between the CETP status and statin-induced reductions in LDL-C levels has
Claudia Bellomo et al.
Cell death and differentiation, 25(5), 885-903 (2017-12-13)
Understanding the complexity of changes in differentiation and cell survival in hepatocellular carcinoma (HCC) is essential for the design of new diagnostic tools and therapeutic modalities. In this context, we have analyzed the crosstalk between transforming growth factor β (TGFβ)
Jasmin R Agarwal et al.
Molecular cancer therapeutics, 13(7), 1873-1881 (2014-05-09)
The Hedgehog (Hh) signaling pathway is aberrantly activated in a wide variety of human cancers, and recent clinical studies have demonstrated that pathway inhibitors are effective in advanced basal cell carcinoma (BCC). The majority of these agents have been designed
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU134631-20UG | 04061828646234 |
| EHU134631-50UG | 04061828420971 |